Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Sphingomonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Regulog: BglR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter sp. NAP1
NAP1_09747 omp(Bgl) -92 5 CCTTGTGAACGCTAACAAAA
Novosphingobium aromaticivorans DSM 12444
Saro_1603 omp(Bgl) -78 5.7 CTGCGTGAACGTTCTCATAT
Saro_1603 omp(Bgl) -60 6 ATAGGTGAACGTTCACAACA
Saro_1611 bglX -34 5.9 GTTTGAGAACGTTCACAGAA
Sphingopyxis alaskensis RB2256
Sala_0914 omp(Bgl) -84 5.3 CGAAGTGAACGTTATCATTT
Sala_0914 omp(Bgl) -66 6 TTACGTGAACGTTCACAATC
Sala_1511 bglX -35 6 AAATGAGAACGTTCACAAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD