Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IdnR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Regulog: IdnR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu4687 Atu4687 -83 6.4 AAATGTTATCGAGAACATTT
Atu4687 Atu4687 -245 5.7 CAATGATACCGATAACATGC
Atu4086 idnO -58 6.4 GAATGTTATCGGTAACATAT
Atu4686 SSF54909 -70 5.7 GCATGTTATCGGTATCATTG
Atu4686 SSF54909 -232 6.4 AAATGTTCTCGATAACATTT
Atu4087 idnD -177 6.4 ATATGTTACCGATAACATTC
Azorhizobium caulinodans ORS 571
AZC_2613 idnD -62 6 GCATGTTATCGGTAACAAAA
AZC_2614 idnO -96 6 TTTTGTTACCGATAACATGC
Bradyrhizobium sp. BTAi1
BBta_0778 idnR -114 5.7 GATTGTTATCGATATCACTG
BBta_0777 idnO -58 6 TCCTGTTATCGATAACATAG
Rhizobium etli CFN 42
RHE_PC00143 COG1063 -98 6.8 ATATGTTATCGATAACATAA
RHE_PC00144 idnO -105 6.8 TTATGTTATCGATAACATAT
RHE_PC00141 idnR -226 6.1 ATTTGTTATCGATATCATCC
RHE_PC00141 idnR -131 4.9 CGATGATAGCGATAACTTTA
RHE_PC00140 gnl -37 6.1 GGATGATATCGATAACAAAT
RHE_PC00140 gnl -132 4.9 TAAAGTTATCGCTATCATCG
RHE_PC00147 null -57 6.8 GAATGTTATCGATAACATAT
Rhizobium leguminosarum bv. viciae 3841
pRL100390 COG1063 -68 6.8 ATATGTTATCGATAACATAA
pRL100391 idnO -104 6.8 TTATGTTATCGATAACATAT
pRL100388 idnR -268 6.1 AATTGTTATCGATATCATCT
pRL100388 idnR -132 4.9 CGATGATAGCGATAACTTTA
pRL100387 gnl -177 4.9 TAAAGTTATCGCTATCATCG
pRL100387 gnl -41 6.1 AGATGATATCGATAACAATT
pRL100394 null -55 6.8 AAATGTTATCGATAACATAC
Rhizobium sp. NGR234
NGR_b22270 idnO -48 6.7 GAATGTTATCGATAACATAA
NGR_b22260 COG1063 -21 6.7 TTATGTTATCGATAACATTC
NGR_b22380 idnR -67 6.5 AGATGTTATCGATAACAAAT
NGR_b22380 idnR -88 4.8 GAAGGTTATCGTTAACTTAG
NGR_b22410 null -54 6.5 TCATGTTATCGATAACATAA
NGR_b22370 Atu4687 -217 6.5 ATTTGTTATCGATAACATCT
Xanthobacter autotrophicus Py2
Xaut_2437 idnO -83 5.7 TCATGTTACCGATATCATGA
Xaut_2436 idnD -81 5.7 TCATGATATCGGTAACATGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD