Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Clostridia-3

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides pectinophilus ATCC 43243
BACPEC_00055 hisZ -41 5.5 CACGTTACCACGCTAAAGTG
Blautia hansenii DSM 20583
BLAHAN_01640 hisR -68 4.6 AAATTTACTGTGCTACTATA
BLAHAN_01245 hisX -61 4.4 CAATTTAGCATAGTAGAGAA
Bryantella formatexigens DSM 14469
BRYFOR_02963 hisZ -109 5.1 CACGGTACCACGCTAAAGTG
Clostridiales bacterium 1_7_47_FAA
Cbac1_010100022442 hisX -59 5.6 CACTTTAGTGTGCTAATATG
Cbac1_010100017829 hisR -167 5.5 AACTTTAATATGTTAAAATG
Cbac1_010100026804 hisZ -65 5.1 CACTTTACTACGAAAAAGTG
Clostridium bolteae ATCC BAA-613
CLOBOL_07128 hisR -113 5.5 GACTTTAATATGCTAAAATG
CLOBOL_01668 hisX -25 5.3 CGCTTTAGTGTGCTAATATG
CLOBOL_03939 hisZ -63 4.8 CACTTTACCATAGAAAAGCA
Clostridium nexile DSM 1787
CLONEX_00021 hisR -54 5 GAGTTTACTGTGCTAAAATA
CLONEX_03079 hisX -54 4.8 TAATTTAGTGTGGTAGAGTA
CLONEX_02879 hisZ -40 4.4 TATTTTAATATGGTAGCGTA
CLONEX_02879 hisZ -32 4.6 TATGGTAGCGTAATAAAGTA
Clostridium scindens ATCC 35704
CLOSCI_02856 hisR -57 5.4 AAATTTAGTGTGTTAAAATG
CLOSCI_00784 hisX -91 5.6 CAATTTAGCGTGGTAAAGTA
CLOSCI_00467 hisZ -47 5.1 CATGGTAGCACACTAAAGTG
Dorea formicigenerans ATCC 27755
DORFOR_03026 hisR -61 5.3 AAATTTACTGTGTTAAAATG
DORFOR_00662 hisX -154 5.3 CGATTTAGCGTGGTAAAGTA
DORFOR_01586 hisZ -35 5 TATGGTAGCACGCTAAAGTG
Dorea longicatena DSM 13814
DORLON_01427 hisR 24 5.3 GAATTTAGTGTGTTAAAATG
DORLON_00748 hisX -94 5.2 GATTTTAGTGTGATAAAGTA
DORLON_00474 hisZ -50 5 CATGGTAGCACACTAAAGTA
Eubacterium eligens ATCC 27750
EUBELI_01562 hisR -68 4.7 AACTTCACTGTGTTAAAATT
EUBELI_01397 hisX -44 5.1 TGATTTACTGTGGTAAAGTG
EUBELI_01024 hisZ -47 4.4 CACTTCAACGCATTAAAGCA
Eubacterium rectale ATCC 33656
EUBREC_1393 hisR -37 5.3 AACTTTAATATGTTAAAATT
EUBREC_2005 hisX -83 5.2 TACTTTAGCGTGATAATTTG
EUBREC_1685 hisZ 23 4.6 CACTTTACTACAAGAAAGCG
Roseburia intestinalis L1-82
ROSINTL182_03943 hisZ -89 5.1 CAAGGTAGCACACTAAAGTG
ROSINTL182_04526 hisR -75 5.6 AACTTTAATATGCTAAAATG
Ruminococcus gnavus ATCC 29149
RUMGNA_03779 hisR -58 5.4 AAATTTAGTGTGATAAAATG
RUMGNA_00302 hisX -64 5.5 CAGTTTAGTATAGTAAAGTG
RUMGNA_02473 hisZ -37 5.1 TGTATTAGCATAGTAAAGTG
Ruminococcus lactaris ATCC 29176
RUMLAC_00772 hisR -59 5.6 AAATTTAGTGTGCTAAAATG
RUMLAC_01337 hisX -70 4.6 GACTTTACCATGGTGCAGTG
RUMLAC_00416 hisZ -40 4.9 CGTATTAGCAGACTAAAGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD