Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CceR (GapR) in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism
Effector: 6-phosphogluconate
Regulog: CceR (GapR) - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_1953 edd -55 5.8 ACATGTTAGCGCTAACATGA
Jann_1969 zwf -37 5.8 CGCTGTTAGCGCTAACGTGA
Jann_1695 gapB -63 5.4 CCCTGTTACCGCTAACACAC
Jann_0447 pykA -80 5.3 GACTGATAGCGCAAACATCG
Jann_0535 pckA -138 4.9 GTATGGTTGCGCTAACTGTG
Jann_1698 gapA -128 4.9 CCGTGTTAGCGCCACCACCC
Jann_1698 gapA -109 4.6 CGATGTTTGCGCCACCGTTT
Jann_1698 gapA -97 5.2 CACCGTTTCCGCTAACATGC
Jann_0818 mdh -101 4.1 GGGCGTTGGGGCTATCGGCC
Jann_1032 tal -71 5.7 TTCCGTTAGCGCTAACATGC
Jann_2674 scrK -40 4.8 AAAGGTTACCGCTAACACGT
Jann_1699 yedI -148 4.9 GGGTGGTGGCGCTAACACGG
Jann_1699 yedI -167 4.6 AAACGGTGGCGCAAACATCG
Jann_1699 yedI -179 5.2 GCATGTTAGCGGAAACGGTG
Jann_1797 eno -84 5.4 GCCTGTTACCGCTAACGGAA
Jann_1693 fba -80 4.8 GCCTGATAGCGCAACCATGA
Loktanella vestfoldensis SKA53
SKA53_03186 zwf -42 5.3 GGGCGTTAGCGCTAACGAAA
SKA53_10229 pykA -39 5.4 TGCTGTTACCGCTAACGGGC
SKA53_05488 edd -58 5.6 CCTTGTTAGCGCTAACACAA
SKA53_13138 pckA -125 5.2 ATTTGGTTGCGCTAACATGC
SKA53_13138 pckA -105 4.8 ATTTGGTTGCGCTAACGTTT
SKA53_02881 gapA -135 5.1 GAATGTTGGCGCAAACATTT
SKA53_02881 gapA -122 4.7 AACATTTAGCGGTAACAGCA
SKA53_02881 gapA -93 5 GTCTGTTACCGTTAACACCC
SKA53_05615 fba -104 5.3 CGCCGTTTGCGATAACATCC
SKA53_05615 fba -83 5.1 GTCCGTTCGCGCTAACATAT
SKA53_01436 scrK -40 5.4 ATTTGTTATCGCTAACAGCC
SKA53_02871 gapB -40 5.6 CAATGTTAGCGCCAACATTC
SKA53_03091 eno -38 5.1 CACTGATACCGCTAACATCG
Oceanicola batsensis HTCC2597
OB2597_02942 zwf -47 4.2 CTATGTTAGCGCCCAAACTC
OB2597_02267 edd -54 5.2 CATTGTTACCGCTAACAAAG
OB2597_10686 pykA -52 4 GATTGATAGCGTTCACATGA
OB2597_10169 pckA -168 4.5 GGGTGATTGCGCTAAAGTTT
OB2597_10169 pckA -148 4.7 ACTTGGTGGCGCTAACTGCG
OB2597_01292 gapA -141 4.9 GCCTGTTAGCGCCAACCCTC
OB2597_01292 gapA -119 4.9 ACGGGTTAGCGCCAACAGGC
OB2597_01292 gapA -100 4.4 CCGGTTTATCGCTAACATAC
OB2597_09589 mdh -60 3.7 CGCTGATCCCGCAAAATGCC
OB2597_15590 tal -133 4.8 TTTCGTTAGCGCTAGCAGAA
OB2597_02982 eno -97 5.3 ATCTGTTTGCGCAAACGCCC
OB2597_01282 gapB -49 5.2 CTATGTTAGCGTTAACGGAC
OB2597_04490 fba -100 5.2 GGGCGTTAGCGCCAACGGGC
Oceanicola granulosus HTCC2516
OG2516_00150 edd -62 5.5 GGTTGTTAGCGGTAACGGCC
OG2516_09243 pykA -74 4.3 TTGCGTTAGCGTTATCGACC
OG2516_08708 pckA -124 4.7 CGCGGGTTGCGCTAACATCA
OG2516_08708 pckA -103 5 CCTTGGTTGCGCTAACTGCG
OG2516_03238 fba -82 5 CCCCGGTGGCGCTAACAGGT
OG2516_03740 eno -36 5.1 GTCCGATAGCGCAAACATCT
Paracoccus denitrificans PD1222
Pden_1952 zwf -65 4.1 GCCTGAAACCGCTATCATCC
Pden_1245 eda -85 5 CTCAGTTAACGCTAACACAC
Pden_1955 edd -48 5.4 CAATGTTACCGCTAACAGGA
Pden_2276 pykA -32 5.2 CGACGATAGCGCAAACATGC
Pden_2852 pckA -132 4.6 AAATGATTGCGCTAACCGTC
Pden_2852 pckA -113 4.5 CTCTGATTGCGCTAACCCTG
Pden_1978 cceR -39 4.1 AAAAGATAACGGTAACATGA
Pden_1920 fba -74 4.6 TTCCGTTAGCGCAATCGCGA
Pden_2946 scrK -77 4.9 GGCAGTTACCGCTATCAGGA
Pden_4465 gapB -124 4 CAATTGCACCGCTAACATCG
Pden_3815 atpH -153 4.7 AGGTGTTTGCGCAATCGGTT
Rhodobacter sphaeroides 2.4.1
RSP_0974 sdhC -189 5.1 GCATGATTGCGCAAACATGT
RSP_2734 zwf -38 6 GGCCGTTAGCGCTAACAGGC
RSP_1680 pckA -188 3.9 CGGAGGTTGCGCCAACCTGT
RSP_1680 pckA -168 5.2 CGCTGGTTGCGCTAACGTCT
RSP_0968 mdh -70 5 TGCCTTTAGCGCAAACATCT
RSP_1663 cceR -98 5.5 GGCCGTTATCGCTAACATGG
RSP_4045 fba -79 4.9 CCAAGTTAGCGCGAACAACA
RSP_2645 eda -2160 5.5 GCTAGTTAGCGCTAACAAAC
RSP_2296 atpH -288 4.8 CGATGTTAGCGGCACCATCG
Rhodobacterales bacterium HTCC2654
RB2654_01815 zwf -60 4.9 TTGGGTTAGCGCTAACAATC
RB2654_03494 edd -65 5.2 GGTTGTTAGCGCTATCACGA
RB2654_16676 pykA -28 5.3 GACTGTTACCGCAAACAGAC
RB2654_15911 pckA -230 5 TGGTGGTTGCGCAAACAGCC
RB2654_15911 pckA -209 4.6 CATTGCTTGCGCTAACGCGA
RB2654_02429 gapA -176 4.7 CCGCGTTTGCGTTAACGGTT
RB2654_02429 gapA -164 4.3 TAACGGTTCCGCTAACGCCC
RB2654_02429 gapA -134 5.1 ATATGTTTTCGCTAACACGC
RB2654_17316 mdh -121 4.4 CACCTTTAGCGGTATCAACG
RB2654_18993 tal -47 4.2 GTATGACACCGCTAACATTT
RB2654_08617 scrK -36 5.1 GACTGATACCGCTAACAACC
RB2654_05195 fba -81 4.4 ATGCGTTAGCGCGACCAGAA
RB2654_03084 eno -85 4.4 CACCGTTGGCGCAACCGCCC
RB2654_02419 gapB -91 5.4 TGATGTTAGCGGTAACGGCG
RB2654_08617 scrK -68 4.1 GGGTGATTGCGCAATCCGCG
RB2654_02434 yedI -138 4.3 GGGCGTTAGCGGAACCGTTA
RB2654_02434 yedI -126 4.7 AACCGTTAACGCAAACGCGG
RB2654_02434 yedI -168 5.1 GCGTGTTAGCGAAAACATAT
Roseobacter sp. MED193
MED193_12017 pykA -78 5.2 TGCTGTTTGCGGTAACATTT
MED193_16479 pckA -183 4.3 CAATGGTTGCGCTAAACTCC
MED193_16479 pckA -162 4.8 CCTTGGTGGCGCTAACTGCG
MED193_16479 pckA -95 3.7 AACCGGTGGCGATACCGGCA
MED193_03557 gapA -132 4.5 AAGCGTTAGCGCCACCGTGT
MED193_03557 gapA -99 3.9 TCCCGTTAACGCCACCGGTA
MED193_03557 gapA -77 4.1 AACCGTTAACGCCACCGGTC
MED193_03557 gapA -58 4.6 CTAGTTTTGCGCTAACATAC
MED193_10071 gapB -110 4 CTCCGTTATCGATACCGATA
MED193_10071 gapB -88 4.9 TAATGTTAGCGATAACGAAT
MED193_07548 pycA -104 4.2 GAATGAGAGCGCAATCATGC
MED193_09260 tal -48 4 AAAGGCTAGCGCAATCAAGG
MED193_03562 yedI -156 4.6 GTATGTTAGCGCAAAACTAG
MED193_03562 yedI -137 4.1 GACCGGTGGCGTTAACGGTT
MED193_03562 yedI -82 4.5 ACACGGTGGCGCTAACGCTT
MED193_20764 fba -100 4.7 GCCCGTTAGCGCAAGCGCTT
MED193_22551 eno -136 4.5 TACCGGTGGCGCAAACAGGT
MED193_22551 eno -116 4 GAATGGTAACGTTAACTGTG
MED193_22551 eno -87 5.1 TGCCGTTAGCGGTAACGAAG
MED193_10066 cceR2 -119 4.9 ATTCGTTATCGCTAACATTA
MED193_17414 pgi -77 5 TACCGTTATCGCTAACAGTA
Roseovarius nubinhibens ISM
ISM_02615 pykA -82 5.1 TGATGTTAGCGATAACGGTA
ISM_13535 pckA -174 5.3 CGCTGGTTGCGCTAACGTCC
ISM_13535 pckA -154 4.6 AATTGGTTGCGCTAACTCAG
ISM_10930 gapA -105 4.6 GAAATTTATCGCTAACAAGG
ISM_03480 tal -123 3.6 GGCGGTTTGCGGCAAATTAT
ISM_08560 cceR -48 4.6 CACCGTTCGCGATAACATTT
ISM_16480 eno -85 5.2 TCGTGTTAGCGATAACATAT
ISM_16480 eno -126 4.1 AACCGTTACCGGCATCATCG
ISM_04665 fba -80 4.6 AGGCGTTAGCGCCACCAAGA
ISM_11730 atpH -302 4.6 TTACGATAGCGGTAACGCCG
Roseovarius sp. 217
ROS217_12046 pykA -51 5.4 CGATGTTAGCGTTAACATTG
ROS217_04095 pckA -197 4.8 GCGCGTTGTCGCTAACATAC
ROS217_04095 pckA -177 5.1 GTCTGGTTGCGCTAACTTGC
ROS217_04095 pckA -157 4.9 GCTTGGTTGCGCTAACTGCA
ROS217_15745 pckA -77 4.8 AAGTGATTGCGCTAACTTGG
ROS217_23117 gapA -150 4.7 TTGCGTTAGCGCAATCACCG
ROS217_23117 gapA -109 4.9 CTAGGTTAACGCTAACATCC
ROS217_09370 cceR -46 4.6 GGGCGTTCGCGGTAACAATG
ROS217_17772 fba -85 4.7 TTCTGTTAGCGCCACCACGA
ROS217_23127 gapB -35 5.7 AATTGTTAGCGCTAACATAT
ROS217_14311 atpH -214 4.6 CCATGATAGCGTTAACGCTT
Silicibacter TM1040
TM1040_0378 pgi -98 5.5 CATTGTTAGCGCTAACTTGG
TM1040_2516 pykA -114 4.9 AAATGTTTGCGTTAACGGTC
TM1040_3042 scrK -93 4.7 AAATGTTAGCGCTTTCAGGT
TM1040_2442 pckA -198 4 TTTTGGTGGCGCTAAAGGTT
TM1040_2442 pckA -177 5.1 GCTTGGTTGCGCTAACGACC
TM1040_1111 gapA -150 4.8 AACAGTTACCGCAAACGCCG
TM1040_1111 gapA -126 4.3 AGGTGTTAACGCCACCATCA
TM1040_1111 gapA -107 4.5 AAGGTTTTGCGCTAACAGTC
TM1040_0417 gapB -85 4.7 CTTCGTTAGCGATAACGATA
TM1040_0417 gapB -60 4.5 GAGTGATAGCGGTACCAGTG
TM1040_2028 pycA -102 4.5 GCAAGTGAGCGCAATCATGC
TM1040_2379 tal -129 5.3 CGCTGTTTACGCTAACATGC
TM1040_0931 eno -214 4.1 AAGGGTGAGCGCTATCATCT
TM1040_0931 eno -89 5.1 AGCCGTTAGCGGTAACGCTT
TM1040_1976 fba -105 5 GGGCGTTAGCGCAACCATTG
TM1040_1112 yedI -124 4.8 CGGCGTTTGCGGTAACTGTT
TM1040_1112 yedI -148 4.3 TGATGGTGGCGTTAACACCT
TM1040_1112 yedI -167 4.5 GACTGTTAGCGCAAAACCTT
TM1040_0378 pgi -130 3.8 GCAAGTTTGCGAAAATTTGG
Silicibacter pomeroyi DSS-3
SPO3033 zwf -65 5.5 ACATGTTAGCGGTAACATTG
SPO2048 zwf -53 5.6 AAATGTTTGCGCTAACAGTG
SPO3600 pykA -43 5.2 GGATGTTTGCGGTAACATAA
SPOA0276 scrK -48 3.8 GCCGGTTTGCGCTGAGATGC
SPO0709 pckA -172 4 TCTTGGTTGCGCTAAACTAT
SPO0709 pckA -151 5 CCTTGGTTGCGCTAACTGCG
SPO2198 gapA -123 4.8 AAGCGTTAGCGCAACCGGGG
SPO2198 gapA -104 5.4 GCAAGTTTGCGCTAACACCT
SPO0701 gapB -59 5.5 TTTTGTTAGCGCTAACAAAT
SPO1171 pycA -104 4.4 GGATGCGAGCGATAACATGC
SPO0349 mdh -130 4.8 CGCTTTTAGCGCAATCACCC
SPO3684 cceR -49 4.6 TGCCGTTCGCGCTAGCATCG
SPO2474 eno -137 5.4 CGCTGTTGGCGCAAACAGGG
SPO2474 eno -117 4.9 ATGTGTTAGCCCTAACTGCG
SPO2474 eno -88 4.9 GCGTGTTAGCGATAGCAGTC
SPO1899 fba -83 4.3 GTAGTTGAGCGCTAACATCC
SPO2197 yedI -99 5.4 AGGTGTTAGCGCAAACTTGC
SPO2197 yedI -80 4.8 CCCCGGTTGCGCTAACGCTT
Sulfitobacter sp. EE-36
EE36_09240 edd -74 5.6 ATAAGTTAGCGCTAACATAC
EE36_08598 pykA -128 5 AAGTGTTAACGCTAACACAT
EE36_08598 pykA -112 5 ACATGTTAACGCTAACTTAT
EE36_04888 pckA -158 4.8 GACAGTTTCCGCAAACAGTT
EE36_04888 pckA -138 4.8 ACATGGTGGCGCTAACTGCG
EE36_13588 gapA -129 4.6 GAGGGTTATCGCTAACACGA
EE36_13588 gapA -110 4.5 AATATTTATCGCTAACATAC
EE36_13578 gapB -35 5.3 CGATGTTAGCGCTATCAAAT
EE36_13593 yedI -83 4.6 TCGTGTTAGCGATAACCCTC
EE36_13593 yedI -102 4.5 GTATGTTAGCGATAAATATT
EE36_15917 eno -148 4.7 CTATGTTGGCGCAACCATCA
EE36_15792 zwf -66 5.6 GTATGTTTGCGCTAACATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD