Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AZL_a08610 in Rhodospirillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: AZL_a08610 - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azospirillum sp. B510
AZL_a08600 dctP -174 5 TTTTGAAAGCGGTTACATAT
AZL_a08600 dctP -107 6.3 CTATGTAAGCGCTTACATCG
AZL_a08610 AZL_a08610 -114 6.3 CGATGTAAGCGCTTACATAG
AZL_a08610 AZL_a08610 -47 5 ATATGTAACCGCTTTCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD