Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AfrR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: 1,5-Anhydro-d-Fructose utilization
Effector:
Regulog: AfrR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Brucella melitensis 16M
BMEI0018 PF06187 -223 5.8 TAATTGGAACGTTCCAAGAC
BMEI0018 PF06187 -56 5.9 CATTTGGAACGTTCTAAACT
BMEI0019 afrR -154 5.9 AGTTTAGAACGTTCCAAATG
Mesorhizobium loti MAFF303099
mll3044 PF06187 -209 5.7 CTATTGGAACGTTCTAATCC
mll3044 PF06187 -45 5.6 TTATTGGAACGTTCCATTTA
mlr3045 afrR -216 5.6 TAAATGGAACGTTCCAATAA
mlr3045 afrR -52 5.7 GGATTAGAACGTTCCAATAG
Rhizobium etli CFN 42
RHE_CH01719 afrR -153 5.2 GATTTAAATCGTTCCAAAAG
RHE_CH01719 afrR -57 6 TTTTTGGAACGTTCCAAATA
Rhizobium leguminosarum bv. viciae 3841
RL1820 afrR -161 5.8 TTTTTAGATCGTTCCAAATT
RL1820 afrR -56 6.2 CAATTGGAACGTTCCAAATA
Rhizobium sp. NGR234
NGR_c32990 PF06187 -246 6.3 TAATTGGAACGTTCCAATTT
NGR_c32990 PF06187 -49 6 AATTTGGAACGATCTAAATT
NGR_c33000 afrR -254 6 AATTTAGATCGTTCCAAATT
NGR_c33000 afrR -57 6.3 AAATTGGAACGTTCCAATTA
Sinorhizobium meliloti 1021
SMc04402 PF06187 -260 6.3 TAATTGGAACGTTCCAATTT
SMc04402 PF06187 -56 6 AATTTGGAACGATCTAAATT
SMc04401 afrR -261 6 AATTTAGATCGTTCCAAATT
SMc04401 afrR -57 6.3 AAATTGGAACGTTCCAATTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD