Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KglR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: KglR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azorhizobium caulinodans ORS 571
AZC_4404 kglR -163 5.6 GTTTTAGATCGGTCTAAAAA
Sinorhizobium meliloti 1021
SMa0079 Sma0079 -77 5.9 ATTTTAGATCGATCTAACTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD