Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Jann_1107 in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_1107 - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_4090 null -93 5.7 GGGTGCATACGAATGCAAAA
Jann_3701 Jann_3701 -36 6.4 TCTTGCAAACCTATGCAAAA
Jann_2640 Jann_2640 -86 6.6 TTTTGCAAACCTATGCAAAA
Jann_1104 PF00815 -81 5.9 TTTTGCAATCGTATGCAGAT
Oceanicola granulosus HTCC2516
OG2516_10551 Jann_2640 -50 5 CCTTGCAAGCGCATGCAAGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD