Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_1425 iolK -126 7.4 TTTTGCAACCGGTTGCAAAA
Jann_1420 iolD -97 6.9 TGTTGCAACCGCTTGCAAAA
Jann_1421 null -44 6.9 TTTTGCAAGCGGTTGCAACA
Jann_1424 iolR -95 7.4 TTTTGCAACCGGTTGCAAAA
Loktanella vestfoldensis SKA53
SKA53_08801 iolD -84 6.9 GGTTGCAACCGGTTGCAAAA
SKA53_08806 null -46 6.9 TTTTGCAACCGGTTGCAACC
SKA53_08821 iolR -95 6.7 AATTGCAACCGGTTGCAAAA
SKA53_08826 iolK -111 6.7 TTTTGCAACCGGTTGCAATT
Silicibacter TM1040
TM1040_3348 iolD -96 7.1 GTTTGCAACCGGTTGCAAAA
TM1040_3347 null -47 7.1 TTTTGCAACCGGTTGCAAAC
TM1040_3344 iolR -100 7.1 CTTTGCAACCGGTTGCAAAA
TM1040_3343 iolK -216 4.9 TTCTGCAACCTCTTTCAACG
TM1040_3343 iolK -106 7.1 TTTTGCAACCGGTTGCAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD