Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mesorhizobium loti MAFF303099
mlr1005 iolR -132 6 GAATGCTACCGGGTGCAAAA
mlr1005 iolR -110 6.5 GTTTGCTACCGGGTGCAAAC
mll1004 iolK -88 6.5 GTTTGCACCCGGTAGCAAAC
mll1004 iolK -66 6 TTTTGCACCCGGTAGCATTC
Rhizobium etli CFN 42
RHE_CH02362 iolR -114 6.5 GTTTGCTACCGGGTGCAAAC
RHE_CH02362 iolR -135 6.3 GATTGCTACCGGGTGCAAAA
RHE_CH02361 iolK -84 6.5 GTTTGCACCCGGTAGCAAAC
RHE_CH02361 iolK -63 6.3 TTTTGCACCCGGTAGCAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD