Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GabR in Corynebacteriaceae

Properties
Regulator family: [Other]
Regulation mode:
Biological process: Gamma-aminobutyrate utilization
Effector:
Regulog: GabR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium aurimucosum ATCC 700975
cauri_0644 gabR -44 5.2 TGGGGATAGAAATTCTGCACGAT
cauri_0649 gabD1 -45 4 ATGGGGTGCAACCCATACACACT
cauri_0645 gabR -44 5.4 AGGGTGTATAAATTTTGCACCTA
cauri_0644 gabR -138 5.5 AATGGTGAGAAATTGTCCACAAT
cauri_0643 gabT2 -207 5.2 ATCGTGCAGAATTTCTATCCCCA
cauri_0643 gabT2 -113 5.5 ATTGTGGACAATTTCTCACCATT
cauri_0646 gabT2 -96 5.4 TAGGTGCAAAATTTATACACCCT
Corynebacterium glutamicum ATCC 13032
cg0565 gabR -50 4.9 GTTGTAGACAATATTTCGCCCAT
cg0566 gabT2 -113 4.9 ATGGGCGAAATATTGTCTACAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD