Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CscR in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Regulog: CscR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03262 cscB -110 6.4 TTATGTTAACGTTAACTTTT
KPN_03262 cscB -46 5.4 TTTTGTTAACGTTACCATAA
KPN_03263 cscR -136 6.4 AAAAGTTAACGTTAACATAA
KPN_03263 cscR -200 5.4 TTATGGTAACGTTAACAAAA
Proteus mirabilis HI4320
PMI0850 cscB -116 6.4 ATATGTTAACGTTAACTTTA
PMI2190 cscA -133 4.9 TCCTGATAACGTTAACATAA
PMI2190 cscA -65 4.6 AAATGTTATCGCTAATAAGG
PMI0850 cscB -53 5.9 TAGAGTTAACGTTAACATTC
Serratia proteamaculans 568
Spro_2083 cscB -114 6.8 AAATGTTAACGTTAACTTTT
Spro_2083 cscB -50 6.3 TAAAGTTAACGTTAACAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD