Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Enterobacteriales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterobacter sp. 638
Ent638_3282 celC -72 6.1 ATTTTTGGTATGCCAATAGT
Ent638_3282 celC -166 5.3 GTAAGTGGTATGCCAAAGTG
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3647 celC -111 5.8 ATTTTTGGTATGCCAAACGC
ECA3647 celC -175 5.6 CATATTGGAATTCCAATATT
ECA3647 celC -206 5.7 GCTTATGGTATGCCAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03250 celC -136 5 ATATTTGGGATACCACTGTG
KPN_03250 celC -167 5.4 GACTCTGGTATGCCAATGTC
KPN_03250 celC -72 5.6 TGTTTTGGTATGCCAAAAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD