Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator QorR in Enterobacteriales

Properties
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_03617 qorR -43 6.6 AAACTTACTTTTAGTAAGTAC
CKO_03618 qorB -34 6.6 GTACTTACTAAAAGTAAGTTT
Enterobacter sp. 638
Ent638_0384 qorR -37 6.3 TAACTAACTTATAGTAAGTAC
Ent638_0383 qorB -67 6.3 GTACTTACTATAAGTTAGTTA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4450 qorR -40 6.1 AAGCTAACTTTAAGTAAGTAC
ECA4449 qorB -81 6.1 GTACTTACTTAAAGTTAGCTT
Escherichia coli str. K-12 substr. MG1655
b4212 qorR -42 6.6 AAACTTACTTTTAGTAAGTAC
b4211 qorB -67 6.6 GTACTTACTAAAAGTAAGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_04606 qorR -42 6.3 TAACTAACTTTTAGTAAGTAC
KPN_04605 qorB -68 6.3 GTACTTACTAAAAGTTAGTTA
Proteus mirabilis HI4320
PMI0975 qorR -42 6.6 AAACTTACTAAAAGTAAGTAC
PMI0976 qorB -68 6.6 GTACTTACTTTTAGTAAGTTT
Salmonella typhimurium LT2
STM4402 qorR -41 6.6 AAACTTACTTTTAGTAAGTAC
STM4401 qorB -67 6.6 GTACTTACTAAAAGTAAGTTT
Yersinia pestis KIM
y1806 qorB -119 5.9 GTACTTACGTAAAGTGAGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD