Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Arth_2426 in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Arth_2426 - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter chlorophenolicus A6
Achl_2180 Arth_2426 -128 6.2 TTGGGAAAGCGCATTCCCAC
Achl_2180 Arth_2426 -79 5.9 GTTGGCAAGCGCTTTCCGGA
Achl_2179 SCO2752 -110 5.9 TCCGGAAAGCGCTTGCCAAC
Achl_2179 SCO2752 -61 6.2 GTGGGAATGCGCTTTCCCAA
Arthrobacter sp. FB24
Arth_2426 Arth_2426 -81 5.7 CATGGCAAGCGCTTTCCCGA
Arth_2426 Arth_2426 -129 6.1 CTGGGAAAGCGCATTCCCAC
Arth_2425 SCO2752 -55 6.1 GTGGGAATGCGCTTTCCCAG
Arth_2425 SCO2752 -103 5.7 TCGGGAAAGCGCTTGCCATG
Beutenbergia cavernae DSM 12333
Bcav_3365 SCO2752 -31 5.8 GCCGGAAAGCGCATTCCCTA
Brachybacterium faecium DSM 4810
Bfae_29090 SCO2752 -116 5.5 CTGGACAAGCGCTTGCCCGA
Janibacter sp. HTCC2649
JNB_06194 Arth_2426 -137 5.4 TGCGGAGAGCGCTTTCCGCT
JNB_06199 null -61 5.4 AGCGGAAAGCGCTCTCCGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD