Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AlsR in Listeriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Allose utilization
Effector: Allose-6-phosphate
Regulog: AlsR - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria monocytogenes EGD-e
lmo0734 alsR -34 5.3 AAATAAAAACGTTTACTCAT
lmo0735 alsE -80 5.5 AAGGTAAAACGATTACTCAT
lmo0735 alsE -35 5.6 ATGAGTAATCGTTATCTCAA
lmo0735 alsE -199 5.3 ATGAGTAAACGTTTTTATTT
lmo0734 alsR -153 5.5 ATGAGTAATCGTTTTACCTT
lmo0734 alsR -198 5.6 TTGAGATAACGATTACTCAT
Listeria welshimeri serovar 6b str. SLCC5334
lwe0703 alsR -151 5.3 ACGGGTAATCGTTTTACCAT
lwe0703 alsR -197 5.6 TTGAGATAACGATTACTCAT
lwe0703 alsR -34 5.4 ATATATAAACGTTTACTCAA
lwe0704 alsE -200 5.4 TTGAGTAAACGTTTATATAT
lwe0704 alsE -37 5.6 ATGAGTAATCGTTATCTCAA
lwe0704 alsE -83 5.3 ATGGTAAAACGATTACCCGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD