Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BH1516 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization
Effector:
Regulog: BH1516 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus clausii KSM-K16
ABC3496 msmE 35 6.3 TAACGTAAACGTTTACTATA
ABC3496 msmE 4 5.6 ATACGAAAACGTTTACTCCC
Bacillus halodurans C-125
BH1516 BH1516 -34 6 CACAGAAAACGTTTTCGTTT
BH0413 amyA -104 6.5 AAAAGTAAACGTTTTCTTTT
BH2903 malL -113 5.9 TCACGTAAACGTTTTCTCTC
BH2903 malL -32 6.3 TTACGTAAACGTTTTCGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD