Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR2 in Listeriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside-6-phosphate
Regulog: BglR2 - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin0540 licH -77 6.8 ACCTGTAATGCATTACATGA
lin0539 bglR2 -114 6.8 TCATGTAATGCATTACAGGT
lin0288 bglH2 -66 6.5 ACCTGTAATGCATTACACAA
lin0017 bglH1 -68 6.6 CTATGTAATGCATTACATAT
Listeria monocytogenes EGD-e
lmo0535 bglR2 -114 6.8 TCATGTAATGCATTACAGGT
lmo0536 licH -77 6.8 ACCTGTAATGCATTACATGA
lmo0018 bglH1 -67 6.6 CTATGTAATGCATTACATAT
lmo0261 bglH2 -66 6.5 ACCTGTAATGCATTACACAA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_0449 licH -78 6.8 ACCTGTAATGCATTACATGA
lse_0246 bglH2 -66 6.4 ACCTGTAATGCATTACACAG
lse_0017 bglH1 -67 6.6 CTCTGTAATGCATTACATAT
lse_0448 bglR2 -114 6.8 TCATGTAATGCATTACAGGT
Listeria welshimeri serovar 6b str. SLCC5334
lwe0495 bglR2 -114 6.8 TCATGTAATGCATTACAGGT
lwe0496 licH -77 6.8 ACCTGTAATGCATTACATGA
lwe0230 bglH2 -66 6.7 ACCTGTAATGCATTACATAG
lwe0018 bglH1 -66 6.6 CTATGTAATGCATTACATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD