Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Micrococcineae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_0088 cebE -59 4.9 CTCAGAGAGCGCTCTCTCGC
AAur_0088 cebE -115 4.6 GTCAGAGAGCGCTCTCTTGA
Arthrobacter chlorophenolicus A6
Achl_0399 cebE -115 6 TGGTGAGAGCGCTCCCATGA
Achl_0399 cebE -170 4.9 CGATGGGAGCGCTCCTAAAT
Achl_0399 cebE -226 5.9 TGGTGGGAGCGCTCCCGTCG
Beutenbergia cavernae DSM 12333
Bcav_2837 cebE -132 6.1 CCGTGAGAGCGCTCCCATGG
Bcav_2837 cebE -96 6 CCTTGGGAGCGCTCTCACCA
Jonesia denitrificans DSM 20603
Jden_1882 cebE -340 6.1 CGGTGGGAACGTTCCCACCG
Jden_1882 cebE -158 5.3 AGGTGGAAACGCTCCCACGC
Jden_1882 cebE -124 5.6 CGGTGGGAGCGCTACCAGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD