Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Caur_3587 in Chloroflexia

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Regulog: Caur_3587 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0492 Caur_3587 -59 6.5 ATATTGACAATTGTCAATAT
Cagg_0491 PF07992 -89 5.9 TTATTGATGTATGTCAATAT
Chloroflexus sp. Y-400-fl
Chy400_3868 Caur_3587 -60 6.6 ATATTGACAATCTTCAATAT
Chy400_3867 PF07992 -43 6 ATATCGATGATCTTCGATAT
Herpetosiphon aurantiacus ATCC 23779
Haur_2824 PF07992 -188 5.9 ATATTGATTTTTTTCAATCT
Haur_2824 PF07992 -41 6.3 ATATTGAAAATTTTCAATTT
Haur_0112 Caur_3587 -50 5.5 ATATTGAATTAATTCGATAA
Roseiflexus castenholzii DSM 13941
Rcas_2311 PF0583 -252 5.6 ATATCGATGATCATCAATAC
Rcas_2310 Caur_3587 -52 6.6 ATATTGACAATCTTCAATAT
Roseiflexus sp. RS-1
RoseRS_1224 ubiE -71 6.5 ATATTGATGATCTTCAATAT
RoseRS_1223 Caur_3587 -22 6.5 ATATTGACATTCTTCAATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD