Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Caur_3401 in Chloroflexia

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Caur_3401 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0354 acrB -69 7 ACTTTACGGTATAGTAAAAA
Chloroflexus sp. Y-400-fl
Chy400_3664 acrB -69 7 ACTTTACGGTATAGTAAAAA
Roseiflexus castenholzii DSM 13941
Rcas_4170 acrB -156 6.6 ATTTTACTGTATAGTAGTCT
Roseiflexus sp. RS-1
RoseRS_4303 acrB -136 6.6 ATTTTACTGTATAGTAGTCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD