Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AcrR in Chloroflexia

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: AcrR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_2437 acrR -44 6.9 ATTACTTACCGGTCGGTAAGAATT
Cagg_0420 Cagg_0420 -51 6.1 GTTACCGACCGGTCGGTCGGTTTT
Chloroflexus sp. Y-400-fl
Chy400_1090 acrR -48 6.9 ATTACTTACCGGTCGGTAAGAATT
Chy400_3788 Cagg_0420 -54 6.2 AATACTTACCGACCGGTCGGTTGG
Roseiflexus castenholzii DSM 13941
Rcas_0269 acrR -86 6.7 ATTCCTGACCGTTCGGTAAAGTGA
Rcas_2058 Cagg_0420 -41 6.3 ACTCCTTACCGACCGGTAAGGAAA
Roseiflexus sp. RS-1
RoseRS_0266 acrR -94 6.7 ATTCCTGACCGTTCGGTAAAGTGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD