Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Caur_3866 in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: Caur_3866 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0091 COG3459 -77 4.9 AAAGTGAAACATTTCACCGA
Cagg_0091 COG3459 103 6 TTTGTGAAACGTTTCATCCA
Cagg_0091 COG3459 -3 5.9 TTTATGAAACGTTACACTCT
Chloroflexus sp. Y-400-fl
Chy400_4165 COG3459 -88 6.1 GTAATGAAACGTTTCATACC
Chy400_4165 COG3459 -193 5.9 CGTATGAAACGTTACACAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD