Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BfrR in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus sp. Y-400-fl
Chy400_2954 bfrR -46 6.2 GTCAATGAACGACCAATCTC
Chloroflexus aggregans DSM 9485
Cagg_3715 bfrR -46 6.4 GTCAATGGACGACCAATCTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD