Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KojR in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Regulog: KojR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_2268 kojR -90 6.5 TTAAGCGAACGTTCGCTTTT
Cagg_2268 kojR -36 6.5 TAAGGCGAACGTTCGCCCTA
Cagg_2267 kojE 170 4.8 AAAAGTGACCGTCCGCTTGT
Chloroflexus sp. Y-400-fl
Chy400_2182 kojR -30 6.5 AAAAGCGAACGTTCGCCTAG
Chy400_2182 kojR -84 6.5 CCAGGCGAACGTTCGCTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD