Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose
Regulog: FruR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_2841 frcR -81 6.3 TCCCGACAACGTTGTCAGGT
CMM_2841 frcR -2 5.8 TCGTGACACCGTTGTCATCC
CMM_2842 frcB -131 5.8 GGATGACAACGGTGTCACGA
CMM_2842 frcB -52 6.3 ACCTGACAACGTTGTCGGGA
Janibacter sp. HTCC2649
JNB_11229 frcR -120 6.5 CGATGACAACGTTGTCATGG
JNB_11229 frcR -42 6.4 CCGTGACATCGTTGTCAGGA
JNB_11239 sacC -34 5.9 GCATGACAACGTTGTCAACG
JNB_11224 frcB -122 6.4 TCCTGACAACGATGTCACGG
JNB_11224 frcB -44 6.5 CCATGACAACGTTGTCATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD