Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BPSL1304 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: BPSL1304 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia cepacia AMMD
Bamb_1118 BPSL1304 -29 6.2 GGTCGAAAACGTTTACATCG
Burkholderia glumae BGR1
bglu_1g10520 BPSL1304 -28 5.4 CCATGGAAACGATTACAGCG
Burkholderia mallei ATCC 23344
BMA3075 RSc1793 -205 6.5 CGACGAAAACGTTTACATCG
BMA3070 BPSL1304 -36 6 CGACGAAAACGTTTACACGC
Burkholderia phymatum STM815
Bphy_1500 BPSL1304 -68 5.4 CTGCGAAAACGTTTACAACA
Burkholderia pseudomallei K96243
BPSL1301 RSc1793 -34 6.5 CGACGAAAACGTTTACATCG
BPSL1304 BPSL1304 -36 6 CGACGAAAACGTTTACACGC
Burkholderia sp. 383
Bcep18194_A4344 BPSL1304 -29 6.2 GGCCGAAAACGTTTACATCG
Burkholderia vietnamiensis G4
Bcep1808_1143 BPSL1304 -29 6.3 CGCCGAAAACGTTTACATCG
Burkholderia xenovorans LB400
Bxe_A1469 BPSL1304 -33 5.6 TCACGAAAACGTTTACGAGC
Bxe_A1468 RSc1791 -138 6.4 CGACGAAAACGTTTACATCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD