Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_7155 iolG -29 6.2 ATTTTGGACCGGTCCAAAGA
SAV_7155 iolG -144 5.9 CTCTTGGACCGTTCCACATC
SAV_7156 iolR -135 6.2 TCTTTGGACCGGTCCAAAAT
SAV_7156 iolR -20 5.9 GATGTGGAACGGTCCAAGAG
Streptomyces scabiei 87.22
SCAB_19101 iolR -102 6.6 CTTTTGGACCGTTCCAAACG
SCAB_19101 iolR -20 5.4 GCTGTGGAACGGTCCAGGCC
SCAB_19091 iolG -29 6.6 CGTTTGGAACGGTCCAAAAG
SCAB_19091 iolG -111 5.4 GGCCTGGACCGTTCCACAGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD