Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR2 in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelR2 - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Serratia proteamaculans 568
Spro_4590 celA2 -96 7.7 AAATGAGAGCGCTCTCATTT
Yersinia pestis KIM
y3950 bglA -210 7.7 AAATGAGAGCGCTCTCATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD