Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Thermoanaerobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermoanaerobacter ethanolicus X514
Teth514_0161 rbsR -53 6.4 ATAGTTAAGCGTTTTACTAA
Teth514_0161 rbsR -40 6 TTACTAAAACGTTAAACCAA
Thermoanaerobacter tengcongensis MB4
TTE0201 rbsR -53 6.4 ATAGTTAAGCGTTTTACTAA
TTE0201 rbsR -40 6.2 TTACTAAAACGTTAAACTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD