Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PdxR3 in Comamonadaceae

Properties
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Methylibium petroleiphilum PM1
Mpe_A2441 pdxR3 -141 5 TGGCCAATCGCCTGATAGTGGATC
Mpe_A2441 pdxR3 -217 4.3 GATCCACTTCGCTCGAAGTGGATT
Mpe_A2442 COG0596 -147 5 GATCCACTATCAGGCGATTGGCCA
Mpe_A2442 COG0596 -71 4.3 AATCCACTTCGAGCGAAGTGGATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD