Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PdxR3 in Nocardiaceae

Properties
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nocardia farcinica IFM 10152
nfa53680 COG0350 -67 5.7 AGTCCAGTTTCGAAAAACTGGACT
nfa53660 pdxR3 -26 4.9 TAGCCAATCCGCGAATACTGGACT
Rhodococcus erythropolis PR4
RER_14310 pdxR3 -26 4.7 TAGCCAAGTTGTCGATACTGGACT
RER_23600 COG2364 -93 3.3 ATGCGGGCTTCACGGAAGTGGCAC
RER_23600 COG2364 -23 4.7 AGTCCAGTATCGACAACTTGGCTA
Rhodococcus opacus B4
ROP_65020 COG2364 -160 3.6 GGTCCAGTAACGCCGACATGGCTA
ROP_56230 COG0350 -137 4 AGTCCAGAAGATCCGGACTGGACC
ROP_56250 pdxR3 -239 4 GGTCCAGTCCGGATCTTCTGGACT
ROP_56250 pdxR3 -29 4.1 TAGCCAAGGGGGTGATACTGGACT
ROP_65020 COG2364 -238 3.5 ACGCCGGCTTCACGGAGGTGGCAC
ROP_64330 pdxR3 -200 3.2 CGGCCAGCCGTTGTATCGCGGGCT
Rhodococcus sp. RHA1
RHA1_ro05556 pdxR3 -236 3.8 AGGCCAGTGCGGATCTTCTGGACT
RHA1_ro05556 pdxR3 -26 3.9 TAGCCAAGAGGTTGATACTGGACT
RHA1_ro06371 pdxR3 -26 3.5 CAGTCCTCTGTGGAAAAGTGGCCT
RHA1_ro06449 COG2364 -6 3.9 GGTCCAGTGCCTGCGTGGTGGCTA
RHA1_ro06449 COG2364 -78 3.7 ACGCCGGTTTCACCGAGGTGGCTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD