Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Phr in Methanomicrobiales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Regulog: Phr - Methanomicrobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Candidatus Methanoregula boonei 6A8
Mboo_1711 phr -20 5.4 AACACTAACATAAAGTAAACATG
Mboo_1603 Mboo_1603 -167 4.3 CGCACTAAAACATTGTTAGTTAT
Mboo_1603 Mboo_1603 -43 4.9 CAGACTAACTAATGGTTAATCCT
Candidatus Methanosphaerula palustris E1-9c
Mpal_2059 phr -21 5.4 CTCCCTAACATAAAGTAAATAAT
Mpal_0298 hsp20-1 -69 5.1 ACCACTTACTTTTGGTTAGTTCA
Methanocorpusculum labreanum Z
Mlab_1236 phr -28 4.3 TCCCCTTACATAATGTAATCTCG
Mlab_1294 hsp20-1 -55 5.2 GTGACTTACTATTAGTAAATCAC
Methanoculleus marisnigri JR1
Memar_1567 phr -20 5.5 ATCACTAACATTTAGTAAATATG
Memar_1986 hsp20-1 -71 5 GACACTACCTTAAGGTTAGCCTC
Methanospirillum hungatei JF-1
Mhun_2633 phr -21 5.7 TTCACTAACATAGAGTTAGTGAT
Mhun_0129 grpE -182 5 TACACTAACTTCAAGTAAATACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD