Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Phr in Methanobacteriales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Regulog: Phr - Methanobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Methanobrevibacter ruminantium M1
mru_2037 phr -149 5.8 TTTAGTAACAAAAAGTTAATATA
mru_2037 phr -238 6.4 TTTAGTAACAAAATGTTATATAA
mru_2038 grpE -448 5.4 TAAAATTACTTTTTGTAAGAAAA
mru_2038 grpE -414 6.4 TTATATAACATTTTGTTACTAAA
Methanobrevibacter smithii ATCC 35061
Msm_1107 phr -46 6.2 TATAGTAACAAAAAGTTATATAA
Msm_1108 grpE -217 6.2 TTATATAACTTTTTGTTACTATA
Methanobrevibacter smithii DSM 2375
METSMIALI_01034 phr -46 6.2 TATAGTAACAAAAAGTTATATAA
METSMIALI_01035 grpE -217 6.2 TTATATAACTTTTTGTTACTATA
Methanosphaera stadtmanae DSM 3091
Msp_1518 grpE -122 6 ATATATAACATTTTGTTACTAAA
Msp_1518 grpE -156 6.3 TTTTGTAACTAAAAGTTATTAAA
Msp_1519 phr -187 6 TTTAGTAACAAAATGTTATATAT
Msp_1519 phr -153 6.3 TTTAATAACTTTTAGTTACAAAA
Methanothermobacter thermautotrophicus str. Delta H
MTH1288 phr -42 5.6 TATACTTACAAAAGGTTATATAA
MTH1289 grpE -88 5.6 TTATATAACCTTTTGTAAGTATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD