Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Phr in Archaeoglobales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Regulog: Phr - Archaeoglobales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Archaeoglobus fulgidus DSM 4304
AF1971 hsp20-2 -56 6 CTACCTAACATAAAGTTAGGTTA
AF1298 phr -34 6.3 AAACCTAACATAAAGTTAGTAAC
Archaeoglobus profundus DSM 5631
Arcpr_1089 hsp20-2 -48 6.2 TTTACTAACTAAAGGTTAGTAGT
Arcpr_0812 phr -43 6.5 TTTACTAACCAAAAGTTAGTAAA
Ferroglobus placidus DSM 10642
Ferp_0363 hsp20-2 -46 6.6 AATCCTAACTTAAAGTTAGGATT
Ferp_0217 phr -58 6.3 TTTACTAACACAAAGTTAGTAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD