Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Phr in Thermococcales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Regulog: Phr - Thermococcales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pyrococcus abyssi GE5
PAB0736 PF1042 -38 6.1 TTTAAATACTTTTAGTTAATAAA
PAB1723 PF1291 -38 5.6 TTTAGTTAATTTTGGTAAGAAAA
PAB1806 PF1488 -24 6.3 TTTAATAACTAAAGGTGAGTAAA
PAB0208 phr -55 5.6 TTTTCTAACATTGGGTTAGAAAA
PAB2072 hsp20 -43 6.2 TTTAATTACTATTGGTAACAAAA
PAB2086 vat -40 6.1 TTTAGTAACCATTGGTAAAGAAA
PAB2107 tip49 -38 5.7 TTTAATAACCATTTGGAAGAAAA
PAB2180 PF1931 -52 5.1 TATAGTATCATGAAGTTAGTAAA
PAB0961 impD -92 5.8 TTTATTAACCTTTTCTTACTAAA
Pyrococcus furiosus DSM 3638
PF0321 impD -93 6 TTTATTAACCAAAGTTTACTAAA
PF0624 PF0624 -45 6 TTTATATACTTTTTGTTACTAAA
PF1042 PF1042 -38 5.8 TTTAAGCACTAAAAGTTATTAAA
PF1291 PF1291 -39 5.6 TTTAGTTAATTTTGGTAAGAAAA
PF1488 PF1488 -59 5 TTTTCTCACCAAATGATTTAAAA
PF1488 PF1488 -25 5.9 TTTAATAACAAATGGTGAAGAAA
PF1616 inoS -119 5.2 TTTATAAACCAAAGTTACTTAAA
PF1616 inoS -66 5 TTTTGTCTATAAAAGTTAATAAA
PF1790 phr -44 6 TTTACTTACAATATGTTAGAAAA
PF1883 hsp20 -43 6.3 TTTAATAACTAATGGTAACCAAA
PF1882 vat -41 6.3 TTTAGTAACCATTGGTAATCAAA
PF1847 tip49 -42 5.7 TTTAATAACAAAATGGAACAAAA
PF0015 PF0015 -41 6 TTTAATAACCTTTTGGAACTAAA
PF0239 PF0239 -18 5.2 TTTAGTTACCTATTGTAAATGAT
PF1931 PF1931 -54 4.6 TATAGTATATTGAAGTTAGTAAA
PF1117 cas2 -164 4.7 TTTCGTAACAAGTAAATAGTAAA
PF1117 cas2 -125 5 AATACTAACTTTGAGTTACTAAA
Pyrococcus horikoshii OT3
PH1122 PF1042 -39 6.1 TTTAAATACATTTAGTTATTAAA
PH1004 PF1291 -38 5.6 TTTAGTTAATTTTGGTAAGAAAA
PH1314 PF1488 -14 6.3 TTTAATAACAATAGGTGATTAAA
PH1842 hsp20 -24 6.2 TTTAGTAACTAATGGTAACCAAA
PH1840 vat -30 6.2 TTTAGTAACCATTAGTAAAAAAA
PH1804 tip49 -38 5.9 TTTAATTACTAAATGGAAATAAA
PHS059 PF0239 -18 5.3 TTTAGTTACCTTAGGTAAATGAT
PH0284 PF1931 -37 5.1 TATAGTATCATGAAGTTAATAAA
PH0600 impD -90 5.5 TTTATTAACCTTTCTTTACTAAA
PH0600 impD -47 5 TTTAAATTCCAAGGGAGAGTAAA
Thermococcus gammatolerans EJ3
TGAM_0933 PF0624 -55 5.6 TTTATATACTCTGGGTTACTAAA
TGAM_1491 PF1042 -33 6 TTTAAGAACAAAAAGTAACTAAA
TGAM_1955 PF1291 -38 5.8 TTTAGTTTCTTTAGGTAAGAAAA
TGAM_0505 PF1488 -23 6 TTTAATAACAAAAGGTGATCAAA
TGAM_0854 phr -41 5.5 TTTTCTAACATTAAGTTAGTAAG
TGAM_1688 hsp20 -99 5 TTTAGTCACCTTTTGTATGGTAA
TGAM_1688 hsp20 -50 5.9 TTTAGTAACTACTGGTAACCAAA
TGAM_1545 tip49 -48 4.8 TTTAGTTACCTTTGGATAGATTA
TGAM_0133 PF0015 -43 5.9 TTTAATAACCTTTTGGAAATAAA
TGAM_0090 PF0239 -42 4.6 TTTAGTAACAATTCTTTAGGATA
TGAM_1372 PF1050 -72 6.1 TTTAGTTACCTTTTGTATTTAAA
TGAM_0280 PF1931 -36 5 AATGGTAACTAAAAGTTACTAAA
TGAM_1373 pfdA -25 6.1 TTTAAATACAAAAGGTAACTAAA
TGAM_0730 impD -89 5.6 TTTATTAACCTGAGTTAACTAAA
Thermococcus kodakaraensis KOD1
TK0750 PF0624 -56 5.9 TTTATATACTCAAGGTTACTAAA
TK1097 PF1042 -53 6.1 TTTAAATACAAAATGTTATTAAA
TK1492 PF1291 -38 5.4 TTTATTTTCTTCAGGTAAGAAAA
TK2294 PF1488 -23 5.9 TTTACTAACCTTTGGTGATGAAA
TK2291 phr -37 5.3 TTTACTAACTTTGGGTTAGGGAA
TK1155 hsp20 -73 4.9 TTTGGTAACTTTCGGAGAGAAAA
TK1155 hsp20 -32 6 TTTAATAACAATTGGTGAGAAAA
TK1157 vat -91 4.7 TTTGGTAACCTCACTTAAGAAAA
TK1157 vat -41 5.8 TTTAGTAACTTACGGTAACCAAA
TK1199 tip49 -42 5 TTTAGTAACCTTCGGTATTCTAA
TK1896 PF0015 -42 6.2 TTTAATAACCTTTGGAAACTAAA
TK2131 PF0239 -45 5.9 TTTAGTTACAATTTTTTATTAAA
TK1120 PF1050 -84 5.1 TTTTCTTACCCATTGTTAAAATA
TK1120 PF1050 -68 5.2 TAAAATAACTTTTGGTATTTAAA
TK0445 cas2 -157 5 GATAGTAACCAAACGTTACTAAA
TK1121 pfdA -59 5.2 TTTAAATACCAAAAGTTATTTTA
TK1121 pfdA -43 5.1 TATTTTAACAATGGGTAAGAAAA
TK1186 impD -93 5.6 TTTATTAACCTAACGTTACTTAA
Thermococcus onnurineus NA1
TON_0117 PF1291 -36 5.3 TTTAGTTAATTTGAGTAAGAAAA
TON_1231 phr -41 5.2 TTTTCTTACATTAAGTTAGGGAA
TON_1113 hsp20 -41 5.9 TTTAGTTACTACTGGTAACCAAA
TON_1650 PF0015 -42 6.1 TTTAATAACCTTTAGAAACTAAA
TON_1528 PF0239 -35 5.3 TTTAGTAACAATTCTTTAGAAAA
TON_1740 PF1931 -37 5.6 ATTGGTAACAAAAGGTAACTAAA
TON_0320 cas2 -164 5.2 GATAATTACTTTATGTTACTAAA
TON_0361 impD -95 5.5 TTTATTAACCTAACTTAACTAAA
Thermococcus sibiricus MM 739
TSIB_0871 PF0624 -62 6 TTTATATACTTATTGTAACTAAA
TSIB_1608 phr -48 5 TTTATTTACATTAGGTTAGATTA
TSIB_0520 hsp20 -11 6.3 TTTAATAACTATTGGTAACCAAA
TSIB_1591 tip49 -45 5.9 TTTAAATACCAATAGTTTCTAAA
TSIB_1989 PF0015 -41 5.9 TTTAATAACCTATAATTACTAAA
TSIB_0908 PF0239 -23 5.4 TTTAGTTACTGATTCTTATTAAA
TSIB_1463 PF1050 -172 5 TTTGTACACTTTTGGTTACTAAC
TSIB_1463 PF1050 -158 4.6 GTTACTAACTTTGGGTTTATAAC
TSIB_1804 PF1931 -83 5.4 TATACTACCAATTGGTAATTAAA
TSIB_1494 cas2 -120 4.9 TTTCAAAACCAAAAGTTAAAAAC
TSIB_1314 impD -85 6.3 TTTATTAACTTAATGTAAATAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD