Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AAur_4078 in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector:
Regulog: AAur_4078 - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_4081 SAV_1326 -177 5.9 AACTGTGTGCGCTCCCAGTA
AAur_4081 SAV_1326 -90 5.9 AACTGGAACCGCTCACAGTC
AAur_4082 lacA -123 5.9 GACTGTGAGCGGTTCCAGTT
AAur_4082 lacA -36 5.9 TACTGGGAGCGCACACAGTT
Beutenbergia cavernae DSM 12333
Bcav_3075 SAV_1329 -73 5.1 AACCGTGATCGTGCACAGGA
Bcav_3076 lacA -147 5.1 TCCTGTGCACGATCACGGTT
Bcav_3075 SAV_1329 -142 5.4 GGCTGGGACCGTGCACAGCA
Bcav_3076 lacA -78 5.4 TGCTGTGCACGGTCCCAGCC
Brachybacterium faecium DSM 4810
Bfae_04140 Bfae_04140 -121 5.7 TACTGTAATCGATCACAGTC
Bfae_03990 lacA 3 4.9 ACCCGTGATCGATTCCAGTT
Bfae_03990 lacA -97 5.9 AACTGTGATCGTTTACAGTC
Bfae_04000 SAV_1326 -79 5.9 GACTGTAAACGATCACAGTT
Bfae_04000 SAV_1326 -179 4.9 AACTGGAATCGATCACGGGT
Jonesia denitrificans DSM 20603
Jden_2125 ganA2 -49 5.1 GTCTGTGACCGGTCACAGAC
Jden_0310 SAV_1326 -178 5.5 CGCTGTGCGCGGTCACAGCC
Jden_0310 SAV_1326 -89 5.5 TCCTGTGACCGGTCACAGCG
Jden_2125 ganA2 -136 5.8 CACTGGGAGCGGGCACAGTT
Jden_0385 ganA -213 6 AACTGGGAGCGCGCACAGTC
Jden_0385 ganA -135 5.5 CCCTGTGACCGGTTACAGTA
Jden_0311 lacA -154 5.5 CGCTGTGACCGGTCACAGGA
Jden_0311 lacA -65 5.5 GGCTGTGACCGCGCACAGCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD