Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bcav_0107 in Micrococcineae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux
Effector:
Regulog: Bcav_0107 - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Beutenbergia cavernae DSM 12333
Bcav_0107 Bcav_0107 -21 5.2 TTGTTCTAGTAGAATACGAACAT
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_2354 Bcav_0107 -21 5.6 TTGTTCGCATAGAATGCGAACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD