Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EF1676 in Enterococcaceae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: EF1676 - Enterococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterococcus faecalis V583
EF1676 EF1676 -46 6.7 TATAGTTAGTTACATAAGTAGTTAACCGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD