Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR2 in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelR2 - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC1558 bglA -97 5.4 TTCAGAAACTGGTTACATTG
VC1558 bglA -110 6.6 TTTTGTAACCGGTTTCAGAA
Vibrio fischeri ES114
VF_0603 celF -85 6.3 ATATGTAACCGGTTACTGAA
VF_0603 celF -72 6.2 TACTGAAACCGGTTACATTT
Vibrio salmonicida LFI1238
VSAL_I0703 celF -71 6.1 TACTGAAACCGGTTACATTG
VSAL_I0703 celF -84 5.7 GCGTGTAACCGGTTACTGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD