Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AAur_2567 in Micrococcineae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: AAur_2567 - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_2567 AAur_2567 -36 7 TATGGTTAGTTACATGAGTAATGAACCAGT
Arthrobacter chlorophenolicus A6
Achl_2889 AAur_2567 -48 6.5 CATGGTTAGTTAGTCAAGTAAGTAACCAAC
Beutenbergia cavernae DSM 12333
Bcav_0486 AAur_2567 -48 5.9 CATGGTTCACTACTTACGTAATGAACCCCC
Brachybacterium faecium DSM 4810
Bfae_06980 AAur_2567 -66 6.4 CATGGTTCATTAGTGGAGTAATGAACCAAC
Brevibacterium linens BL2
BlinB01001376 AAur_2567 -45 6.9 CATGGTTAGTTAGTTGAGTAACTAACCAAC
Jonesia denitrificans DSM 20603
Jden_1559 AAur_2567 -36 6.6 ATAGGTTAGTTACATGAGTAATGAACCAGT
Kocuria rhizophila DC2201
KRH_20790 AAur_2567 -46 6 TGTGGTTCCTTAGTAAAGTAATGAACCAAG
Kytococcus sedentarius DSM 20547
Ksed_02920 AAur_2567 -42 6.8 AATGGTTAGTTAGTCAAGTAACTAACTAAC
Renibacterium salmoninarum ATCC 33209
RSal33209_1480 AAur_2567 -72 5.7 TTAGGTTAGTTGTATGAGTAATGAACCGGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD