Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cg3261 in Corynebacteriaceae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Cg3261 - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium amycolatum SK46
CORAM0001_0934 lp_2742 -47 3.9 TTAGGTTTATGACATAGGTGGTATACCCGT
Corynebacterium aurimucosum ATCC 700975
cauri_2429 lp_2742 -42 6.5 TATGGTTAGCTACATGAGTAACCAACCAGC
Corynebacterium diphtheriae NCTC 13129
DIP2280 lp_2742 -33 7 TATGGTTAGTTACATGAGTAACCAACCAAC
Corynebacterium efficiens YS-314
CE2809 lp_2742 -50 6.5 TAGGGTTAGTTACCTGAGTAACTAACCAAT
Corynebacterium glutamicum ATCC 13032
cg3261 lp_2742 -39 6.4 TAGGGTTAGTTATATGAGTAACCAACCATC
Corynebacterium jeikeium K411
jk0088 lp_2742 -109 7 TATGGTTAGTTACACAAGTAACCAACCAAC
Corynebacterium urealyticum DSM 7109
cur_1282 lp_2742 -17 3.5 TTAGGTTTATGACCTACATGGTAAACCCCA
cur_0107 lp_2742 -124 6.8 TATGGTTGGTTACACAAGTAACTAACCGAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD