Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AAur_3503 in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: AAur_3503 - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_3501 AAur_3501 -163 6.8 CTTTGGAATCGATTCCACGG
AAur_3501 AAur_3501 -118 6.6 ATTTGGAATCGATTCCACGA
Arthrobacter sp. FB24
Arth_3687 AAur_3501 -162 7 CTTTGGAATCGATTCCACAG
Arth_3687 AAur_3501 -117 7 TTTTGGAATCGATTCCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD