Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR3 in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelR3 - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRB2008 celB2 -19 6 TACGGAAACCGGTTTCCATT
Vibrio shilonii AK1
VSAK1_16467 celB2 -73 6.4 TTTGGAAATCGGTTTCCAAA
VSAK1_16482 celR3 -56 5 TTTGGGAAACGGTTTCCCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD