Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ExuR in Clostridia-1

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galacturonate utilization
Effector: Galacturonate
Regulog: ExuR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium butyricum 5521
CBY_3715 null -43 6 AATTGTTAACGATAACAATA
CBY_2353 pelX -34 5.9 AATTGTTAACGTTAACTATA
CBY_2353 pelX -122 5.3 AATTGTTAACGTTAAACTTA
CBY_0243 rhiN -197 4.5 TTTGGAAAACGTGTTCAATT
CBY_0243 rhiN -96 5 AAATGTGCACGTGTGCAAAA
Clostridium acetobutylicum ATCC 824
CAC0695 uxaB -42 5.2 TTTTGAACACGTGAACGTAA
CAP0056 pell -46 6.1 AAATGTTAACGTTAACATAA
CAC0695 uxaB -130 5.4 AAATGTTCACGTGTTCAAAA
CAC0692 uxaC -121 5.7 AGTTGTTCACGTTCACAAAA
CAC0804 pelA -100 5.4 AATTGTTAACGTTAAACAAA
CAC0804 pelA -42 4.6 TATGTTTATCGTAAACAAAA
CAC2774 mcp -51 5.3 TTTTGTTAACGTTATCTGTA
CAC2774 mcp -38 4.5 ATCTGTATACGATAACAATT
CAC0812 pelL -167 5.7 GTTTGTTAACGATAACAATA
CAC0804 pelA -106 4.5 TAATGTAATTGTTAACGTTA
CAC0359 rhiN -72 5.7 TATTGATAACGTGAACACTA
CAC0359 rhiN -195 5.7 CTTTGTTAACGTTAACGTAA
Clostridium beijerincki NCIMB 8052
Cbei_1832 uxaC -148 5.8 AGTTGTTAACGTTCACAAAA
Cbei_1832 uxaC -71 5 AAATGTTCACGTGAACAGGG
Cbei_1832 uxaC -39 6.4 TTTTGTTCACGTGAACAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD