Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgaR in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_2696 bgaR -2 6.5 GGGTGTTTGCGCAAACATCT
CMM_2697 bgaY -94 6.5 AGATGTTTGCGCAAACACCC
Jonesia denitrificans DSM 20603
Jden_0101 bgaX -175 6.3 CGATGTTTGCGTAAACATGC
Jden_0100 bgaR -143 6.5 CGATGTTTACGTCAACATCT
Jden_0100 bgaR -111 6.3 GCATGTTTACGCAAACATCG
Jden_0101 bgaX -143 6.5 AGATGTTGACGTAAACATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD