Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SgaR in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Regulog: SgaR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_00488 sgaR -175 6.1 CAAAGATAGCGCTATCAAAA
CKO_00488 sgaR -141 6.2 ATGTGATAGCGCTATCAAAA
CKO_00489 sgaA -128 6.1 TTTTGATAGCGCTATCTTTG
CKO_00489 sgaA -162 6.2 TTTTGATAGCGCTATCACAT
Edwardsiella tarda EIB202
ETAE_3025 sgaR -242 5.8 CAATGGTAGCGCTATCTAGT
ETAE_3025 sgaR -208 6.1 TCGTGATAGCGCTATCATTT
ETAE_3026 sgaA -122 6.1 AAATGATAGCGCTATCACGA
ETAE_3026 sgaA -88 5.8 ACTAGATAGCGCTACCATTG
Enterobacter sp. 638
Ent638_2847 sgaR -161 5.6 CAAAGATAGCGCTACCAATC
Ent638_2847 sgaR -127 6.2 TTGTGATAGCGCTATCAAAT
Ent638_2846 sgaA -129 6.2 ATTTGATAGCGCTATCACAA
Ent638_2846 sgaA -95 5.6 GATTGGTAGCGCTATCTTTG
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3772 sgaR -228 5.3 AAAAGGTAGCGCTAACTGAT
ECA3773 sgaA -91 5.3 ATCAGTTAGCGCTACCTTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_01748 sgaR -138 5.4 CAAAGTTAGCGCTAACAAAG
KPN_01747 sgaA -90 5.4 CTTTGTTAGCGCTAACTTTG
Photorhabdus luminescens subsp. laumondii TTO1
plu1978 sgaR -177 6.2 AAATGATAGCGCTATCTATG
plu1978 sgaR -143 6.3 TTGTGATAGCGCTATCATTT
plu1979 sgaA -115 6.3 AAATGATAGCGCTATCACAA
plu1979 sgaA -81 6.2 CATAGATAGCGCTATCATTT
Proteus mirabilis HI4320
PMI1778 sgaR -171 5.8 TAATGGTAGCGCTATCTAGA
PMI1778 sgaR -137 5.8 TTGTGATAGCGCTATTATTT
PMI1777 sgaA -75 5.8 TCTAGATAGCGCTACCATTA
PMI1777 sgaA -109 5.8 AAATAATAGCGCTATCACAA
Salmonella typhimurium LT2
STM2345 sgaR -141 6.2 TTGTGATAGCGCTATCAAAT
STM2345 sgaR -175 5.3 CAAAGATAGCGCTACCAGCG
STM2344 sgaA -131 6.2 ATTTGATAGCGCTATCACAA
STM2344 sgaA -97 5.3 CGCTGGTAGCGCTATCTTTG
Yersinia pestis KIM
y1619 sgaR -156 6.3 TTGTGATAGCGCTATCATTT
y1619 sgaR -177 5.9 ATCTGGTAGCGCTATCAAAA
y1619 sgaR -190 5.9 AATTGATAGCGCTATCTGGT
y1618 sgaA -128 6.3 AAATGATAGCGCTATCACAA
y1618 sgaA -107 5.9 TTTTGATAGCGCTACCAGAT
y1618 sgaA -94 5.9 ACCAGATAGCGCTATCAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD