Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Deinococcus-Thermus

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus deserti VCD115
Deide_00590 bglR -90 6.3 TCTTGACAGCGCTTTCAAAA
Deinococcus geothermalis DSM 11300
Dgeo_2858 bglR -31 5.8 TTTTGCAACCGCTTTCAGAT
Dgeo_2859 bglE -147 5.6 GTTGACAAGCGCTTTCAAAG
Thermus thermophilus HB27
TTP0038 bglR -21 6.3 TCTTGCAAGCGCTTTCAACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD