Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio harveyi ATCC BAA-1116
VIBHAR_06943 bglR -60 5.5 CCATGAAAGCGGTTTCGGAG
VIBHAR_06946 bglP -206 6.2 AAATGAAAGCGATTTCAAAT
Vibrio splendidus LGP32
VS_II1392 bglR -41 5 TTTTGTAAGCGGTTACAAGC
VS_II1393 bglP -207 5.9 AAATGAAAGCGATTTCAAGC
VS_II1392 bglR -140 5.7 ATCTGTAAGCGCTTTCATGA
Vibrio vulnificus CMCP6
VV21281 bglP -164 6 AAATGAAACCGATTTCAAAT
VV21282 bglR -48 5.6 GCATGAAAGCGGTTTCGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD