Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRA0495 celB -150 6.7 TCGCGCAACCGGTTGCGCTT
PBPRA0494 celG -286 6.4 AAGCGCAACCGGTTGCGCGA
Vibrio cholerae O1 biovar eltor str. N16961
VC1281 celB -83 6.9 TAACGCAACCGGTTGCGCTT
VC1280 celG -179 6.8 AAGCGCAACCGGTTGCGTTA
Vibrio harveyi ATCC BAA-1116
VIBHAR_03625 celB -84 6.7 CAATGCAACCGGTTGCGCTT
VIBHAR_03626 celG -184 6.6 AAGCGCAACCGGTTGCATTG
Vibrio parahaemolyticus RIMD 2210633
VP2637 celB -84 7.1 TAGCGCAACCGGTTGCGCTT
VP2638 celG -183 7 AAGCGCAACCGGTTGCGCTA
Vibrio vulnificus CMCP6
VV1_1482 celB -127 6.7 CAATGCAACCGGTTGCGCTT
VV1_1481 celG -206 6.6 AAGCGCAACCGGTTGCATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD